| Internal ID | 1426494 | Source Database | PseudoCAP 1426494 |
| Feature Type | motif |
| Name |
TrpI binding site I
|
| Sequence |
ACCTGTCAGGAAAACTCACGAAT Look for more occurrences |
| Start | 39175 |
| End | 39197 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
runoff transcription assay
|
| Additional Comments |
| Xref | PseudoCAP:PA0037 |
|
The roles of indoleglycerol phosphate and the TrpI protein in the expression of trpBA from Pseudomonas aeruginosa.
Chang M, Crawford IP
Nucleic Acids Res. 1990 Feb;18(4):979-88
PubMed ID: 2107533
|