| Internal ID | 1426500 | Source Database | PRODORIC PT000028 |
| Feature Type | motif |
| Name |
TrpI binding site II
|
| Sequence |
AAGAAACCGATAAGATTGCGGCA Look for more occurrences |
| Start | 39152 |
| End | 39174 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
runoff transcription assay
|
| Additional Comments |
| Xref | PseudoCAP:PA0037 |
|
Activation of the trpBA promoter of Pseudomonas aeruginosa by TrpI protein in vitro.
Gao JG, Gussin GN
J. Bacteriol. 1991 Jun;173(12):3763-9
PubMed ID: 1904858
|