Motif View

Internal ID 17655800
Source Database TransTermHP TERM 320
Feature Type terminator
Name
Rho-independent transcription terminator TERM 320
Sequence CGGGAGTCCCCGGAGGGACTCCCG
Look for more occurrences
Start 1265099
End 1265122
Strand -
Genomic Context
Replicon Pseudomonas aeruginosa PAO1 chromosome, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments CTCGACCTTTCAAGA(5' tail) CGGGAGTCCC(5' stem) TCCG(loop) GGGACTCCCG(3' stem) TTTTTTTATGCGTCG(3' tail). Confidence: 90. opp_overlap 1265099

Reference

Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685