Motif View

Internal ID 964409
Source Database RegTransBase 62037
Feature Type site
Name
putative DnaA binding site3 upstream of dnaA
Sequence TGTGCATAGCCCTCATGGGCGTTTATCCACAGGGCTTATTCACAG
Look for more occurrences
Start 201
End 245
Strand +
Genomic Context
Replicon Pseudomonas putida F1 chromosome, complete genome.
Evidence
Additional Comments

Reference

Expression and regulation of a dnaA homologue isolated from Pseudomonas putida.
Ingmer H, Atlung T
Mol. Gen. Genet. 1992 Apr;232(3):431-9
PubMed ID: 1588913