| Internal ID | 1426285 | Source Database | PseudoCAP 1426285 |
| Feature Type | motif |
| Name |
transcription terminator T2
|
| Sequence |
CGGCGTGCCGTCGTGCGGCACGCCG Look for more occurrences |
| Start | 3776916 |
| End | 3776940 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Transcriptional analysis of the amidase operon from Pseudomonas aeruginosa.
Wilson SA, Drew RE
J. Bacteriol. 1995 Jun;177(11):3052-7
PubMed ID: 7539417
|