| Internal ID | 1426420 | Source Database | PseudoCAP 1426420 |
| Feature Type | motif |
| Name |
putative lux box
|
| Sequence |
TCCTGCGAACTCTAGCAGTG Look for more occurrences |
| Start | 3772853 |
| End | 3772872 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
| Xref | PseudoCAP:PA1430 |
|
The sigma factor AlgU plays a key role in formation of robust biofilms by nonmucoid Pseudomonas aeruginosa.
Bazire A, Shioya K, Soum-Soutéra E, Bouffartigues E, Ryder C, Guentas-Dombrowsky L, Hémery G, Linossier I, Chevalier S, Wozniak DJ, Lesouhaitier O, Dufour A
J. Bacteriol. 2010 Jun;192(12):3001-10
PubMed ID: 20348252
|