| Internal ID | 1426503 | Source Database | PseudoCAP 1426503 |
| Feature Type | motif |
| Name |
putative transcription terminator
|
| Sequence |
ACGGACACTCCCAAGGGGTGTCCGT Look for more occurrences |
| Start | 60176 |
| End | 60200 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Genetic relationship between the 53- and 49-kilodalton forms of exoenzyme S from Pseudomonas aeruginosa.
Yahr TL, Barbieri JT, Frank DW
J. Bacteriol. 1996 Mar;178(5):1412-9
PubMed ID: 8631719
|