| Internal ID | 1571752 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
RhlR binding site
|
| Sequence |
TCCTGTGAAATCTGGCAGTT Look for more occurrences |
| Start | 3893269 |
| End | 3893288 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,EMSA,Visual sequence inspection,Consensus search [PMID:14526008] | Beta-gal reporter assay,EMSA,Visual sequence inspection,Consensus search [PMID:14526008] | Beta-gal reporter assay,Site directed mutagenesis
|
| Additional Comments |