Internal ID | 17656195 | Source Database | TransTermHP TERM 925 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 925
|
Sequence |
GAAAGCCGACCCTCGGGTCGGCTTTC Look for more occurrences |
Start | 4067566 |
End | 4067591 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCCTGCAACGACAA(5' tail) GAAAGCCGACC(5' stem) CGAG(loop) GGTCGGCTTTC(3' stem) TTGTGCCAGGGTTCA(3' tail). Confidence: 95. opp_overlap 4067566 4067570, overlap 4067563 4067570 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|