| Internal ID | 17656296 | Source Database | TransTermHP TERM 1112 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1112
|
| Sequence |
GCCCGCCACGCTTGTCGTGGCGGGC Look for more occurrences |
| Start | 4884678 |
| End | 4884702 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCAGCCAGGAAGA(5' tail) GCCCGCCACG(5' stem) CTTGT(loop) CGTGGCGGGC(3' stem) TCTGTGCTTTGCCCG(3' tail). Confidence: 91. opp_overlap 4884676, overlap 4884676 4884672 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|