| Internal ID | 17662337 | Source Database | TransTermHP TERM 5 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 5
|
| Sequence |
GAAGCCCCGCTATGGCGGGGCTCC Look for more occurrences |
| Start | 6951 |
| End | 6974 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCGCGTGAAAACAG(5' tail) GAAGCCCCGC(5' stem) TATG(loop) GCGGGGCTCC(3' stem) TTTTATCGAATCGGC(3' tail). Confidence: 100. opp_overlap 6950 6951 6948 6954, overlap 6954 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|