| Internal ID | 17663197 | Source Database | TransTermHP TERM 1406 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1406
|
| Sequence |
CGGGGCGGCTATAATCGCCGCCCCG Look for more occurrences |
| Start | 6085980 |
| End | 6086004 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCTTTCCGATGCCCG(5' tail) CGGGGCGGCTA(5' stem) TAA(loop) TCGCCGCCCCG(3' stem) TTTTGCCGCCACCGC(3' tail). Confidence: 100. overlap 6085951 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|