| Internal ID | 965454 | Source Database | RegTransBase 87029 |
| Feature Type | site |
| Name |
Anr putative half-site at hemA promoter 2
|
| Sequence |
TTGAACCTGCGAGGGTGGCGCCATCA Look for more occurrences |
| Start | 5234998 |
| End | 5235023 |
| Strand | - |
| Genomic Context | Located within gene lbcA |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Regulation of the hemA gene during 5-aminolevulinic acid formation in Pseudomonas aeruginosa.
Hungerer C, Troup B, Römling U, Jahn D
J Bacteriol 1995 Mar;177(6):1435-43
PubMed ID: 7883699
|