Internal ID | 17657197 | Source Database | TransTermHP TERM 982 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 982
|
Sequence |
CGGGGCGCCCCTGGGCGCCCCG Look for more occurrences |
Start | 4379238 |
End | 4379259 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCCGCTAAGAGCAA(5' tail) CGGGGCGCC(5' stem) CAGG(loop) GGCGCCCCG(3' stem) TCCTCTTTCTCCGTC(3' tail). Confidence: 93. opp_overlap 4379238 4379232, overlap 4379218 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|