Internal ID | 17657253 | Source Database | TransTermHP TERM 1071 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1071
|
Sequence |
GGAACCCGGCCGCGGCCGGGTTTC Look for more occurrences |
Start | 4702393 |
End | 4702416 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AAAAGCAGGCCAAAA(5' tail) GAAACCCGGC(5' stem) CGCG(loop) GCCGGGTTCC(3' stem) TTCATTTCGACTAAG(3' tail). Confidence: 100. opp_overlap 4702389 4702393, overlap 4702397 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|